Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Statistical analyses br All the

    2020-08-12


    2.9. Statistical analyses
    All the analysis were carried out triplicate and obtained values were expressed as the means ± standard deviation (SD) that was calculated by Microsoft Excel 2016. Statistical analyses were performed using Student’s t-test and ANOVA for two groups and multiples comparison respectively. P value less than 0.05 was considered to be statistically 
    significant.
    3. Results
    3.1. Preparation and characterization of [DOX + SC]-coloaded NLC-RGD
    [DOX + SC]-coloaded NLC-RGD were prepared by modified hot homogenizing method using different percentage of Precirol, Miglyol and Poloxamer. In this process approximately 10 different formulations (table. 2) were assessed according to nanoparticle size, polydispersity index and loading capacity for both drugs. Based on mentioned para-meters, the optimum formulation was composed of 110 mg Precirol as central substance of nanoparticles, 15 mg Miglyol as stabilizer and 30 mg Poloxamer as surfactant of NLC. DLS graph showed that mean particle size of prepared NPs was 80.5 nm with 0.23 PDI (Fig. 1a). Subsequently these results confirmed by scanning Nivolumab microscope imaging (Fig. 1b) which showed spherical morphology with nanoscale size and narrow polydispersity for prepared nanoparticles. Zeta po-tential analysis showed a negative value of −18.5 mV surface charge at the original pH 7.4 (Fig. 1c).
    3.2. Encapsulation efficiency (EE) and stability
    Encapsulation efficiency is an important factor for selecting op-timum formulation. Fig. 2 shows the ultraviolet-visible calibration curve of SC and DOX which are used for calculation of unloaded drugs and subsequently EE. EE for DOX and SC in different formulation was reported in Table 2. EE for DOX and SC in optimum formulation were 56.04 ± 1.25% and 81.62 ± 3.14% respectively. [DOX + SC]-co-loaded NLC-RGD showed no notable alteration in clarity and phase separation when stored in 2–6 °C for 8 weeks. After this period, size and PDI of nanoparticles was 86.2 nm and 0.28 which showed that prepared NPs are stable minimum for 8 weeks at 2–6 °C (Fig. 1a). Furthermore, after 8 weeks storage at 2–6 °C, the unloaded form of DOX and SC was 61.03% and 26.54% respectively which shows that during these 8 weeks, approximately 17% of DOX and 8% of SC were released from nanoparticles.
    3.3. In vitro cell viability study
    MTT assay was performed to determine cytotoxicity of DOX, SC and synergistic effects of combinatorial treatment of DOX and SC in free form and in the form of co-loaded to NLC-RGD on A549 lung cancer cell line. Results showed that SC (up to 80 μM) and blank NLC-RGD has no remarkable cytotoxicity (Fig. 3a). Co-treatment of the cells with 1 μM of DOX and serial of different concentrations of SC showed that, SC causes a notable increase in DOX cytotoxicity in concentration of ≥15 μM (Fig. 3b). due to numerous side effects of SC, we decided to select minimum effective concentration of SC for rest of experiments. Re-garding to encapsulation efficiency of DOX and SC, 15 μM of SC in formulation is equivalent with 1.26 μM of DOX. Data analysis of the cytotoxicity assay also revealed that combination treatment of the cells with [15 μM free SC + 1.26 μM free DOX], [15 μM SC + 1.26 μM DOX co-loaded NLC] and [15 μM SC + 1.26 μM DOX co loaded NLC-RGD] results in 70.62%, 65.47%, 51.36% cell viability, which shows that [SC + DOX]-coloaded NLC-RGD has 19.26% and 14.11% more
    Table 1
    Primers sequences.
    Gene Forward Primer (5'–3' direction) Reverse Primer (5'–3' direction) Products size (bp)
    ABCB1 TGACAGCTACAGCACGGAAG TCTTCACCTCCAGGCTCAGT 131 ABCC1 GGGCTGCGGAAAGTCGT AGCCCTTGATAGCCACGTG 80 ABCC2 TACCAATCCAAGCCTCTACC AGAATAGGGACAGGAACCAG 104 Nrf2 CCAAAACCACCCTGAAAGCAC GTGATGCCACACTGGGACT 83 GAPDH GACAGTCAGCCGCATCTTCT TTAAAAGCAGCCCTGGTGAC 127
    Table 2
    Composition and characteristics of prepared nanoparticles.
    Formulation Code Precirol (mg) Miglyol (mg) RGD-PEG-DSPE (mg) Poloxamer (mg) Size (nm) PDI EE for DOX (%) EE for SC (%)
    PDI: polydispersity index, EE: encapsulation efficiency, RGD-PEG-DSPE: Arginyl-glycyl-aspartic acid -distearoyl-sn-glycero-phosphoethanolamine-N-[amino (poly-ethylene glycol)].
    Fig. 1. Characteristic of [DOX + SC]-coloaded NLC-RGD. a) Size and polydispersity index (PDI) of nanoparticles, (Ⅰ) after preparation, (Ⅱ) after 8 weeks of storage at 2–6 °C. b) Scanning electron microscopy (SEM) image of prepared nanoparticles. c) Zeta potential distribution of [DOX + SC]-coloaded NLC-RGD. (DOX, Doxorubicin; SC, Sildenafil Citrate; NLC-RGD, Arginyl-glycyl-aspartic acid containing nanostructured lipid carriers).