Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Sakurai T He G Matsuzawa A Yu

    2020-08-30


    Sakurai, T., He, G., Matsuzawa, A., Yu, G.Y., Maeda, S., Hardiman, G., and Karin, M. (2008). Hepatocyte necrosis induced by oxidative stress and IL-1 alpha release mediate carcinogen-induced compensatory proliferation and liver tumorigenesis. Cancer Cell 14, 156–165.
    STAR+METHODS
    KEY RESOURCES TABLE
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Antibodies
    Rabbit monoclonal Histone H3 Cell signaling Cat#9715S; RRID AB_331563
    YoYo-1 dye ThermoFisher Scientific Cat#Y3601
    Rabbit polyclonal CitH3 GS-9620 antibody Abcam Cat#Ab5103; RRID AB_304752
    Alexa Fluor 647 Phalloidin Invitrogen by ThermoFisher Scientific Cat#A22287; RRID AB_2620155
    Goat anti-Rabbit Secondary antibody AF488 Invitrogen by ThermoFisher Scientific Cat#A-11008; RRID AB_143165
    Donkey anti-Goat Secondary antibody AF594 Invitrogen by ThermoFisher Scientific Cat#A-11058; RRID AB_142540
    Biotin Goat Anti-Rabbit Ig
    BD PharMingen
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    Bacterial and Virus Strains
    Salmonella-GFP S. Balachandran (FCCC) from (Radtke et al., 2007)
    M. O’Riordan lab (University
    of Michigan)
    E.coli
    Zymo Research
    Chemicals, Peptides, and Recombinant Proteins
    IL-1b recombinant protein Peprotech Cat #211-11B
    CM-H2DCFDA dye Invitrogen by ThermoFisher Scientific Cat #C6827
    Zymosan A BioParticles, Alexa Fluor 594 conjugate Invitrogen by ThermoFisher Scientific Cat #Z23374
    Yellow ‘‘Live/Dead’’ fluorescent reactive dye Invitrogen by ThermoFisher Scientific Cat #L34968
    Ionomycin Invitrogen by ThermoFisher Scientific Cat #I24222
    Fixation/Permeabilization kit (RUO) BD Biosciences Cat #554714
    BD BBL Stacker Plate (CDC Anaerobe blood agar) BD Biosciences Cat #221733
    Collagenase from Clostridium histolyticum (Type VIII) Sigma Cat. #C2139-5G
    Anakinra (Kineret) Amgen/ FCCC Pharmacy Rx
    Vancomycin Hydrochloride for Injection, USP FCCC Pharmacy NDC 0409-6531-02
    Neomycin trisulfate salt hydrate Sigma Cat #N1876
    Ampicillin sodium salt Sigma Cat #A9518
    Metronidazole Sigma Cat #M3761
    Polymixin B Sulfate Milipore Cat #M5291
    Tamoxifen
    Sigma
    Critical Commercial Assays
    QIAamp DNA Stool Mini kit QIAGEN Cat # 51504
    RNeasy Plus Mini kit QIAGEN Cat# 74136
    EasySep Mouse Neutrophil Enrichment Kit StemCell technologies Cat#19762A
    Trans-Blot Turbo Transfer Pack Bio-Rad Cat #1704156
    Streptavidin HRP BD PharMingen Cat #554066
    iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad Cat #170-8841
    iTaq Universal SYBR Green Supermix
    Bio-Rad
    Deposited Data
    16S RNA microbiome sequencing NCBI SRA Database https:// BioProject:PRJNA480459; SRA
    www.ncbi.nlm.nih.gov/bioproject
    Experimental Models: Organisms/Strains
    Mouse: Apcf/f Eric Fearon (University of Michigan) (Hinoi et al., 2007)
    (Continued on next page)
    Continued
    REAGENT or RESOURCE SOURCE IDENTIFIER
    available from Jackson Laboratories Cre/ERT2)752Erf/J
    Mouse: CDX2Cre Jackson Laboratories B6.Cg-Tg(CDX2-cre)101Erf/J
    Mouse: RorcGFP
    Jackson Laboratories B6.129P2(Cg)-Rorctm2Litt/J
    Mouse: Ly6GCre-Il1r1f/f Ari Waisman and Matthias Gunzer (Hasenberg et al., 2015); (Bruttger
    (University Mainz and University et al., 2015)
    Duisburg-Essen)
    Mouse: CD4Cre Jackson Laboratories Tg(Cd4-cre)1Cwi/BfluJ Stock 017336
    Mouse: CD11bCre
    Mouse: CX3CR1Cre Jackson Laboratories B6J.B6N(Cg)-Cx3cr1tm1.1(cre)Jung/J
    Mouse: CD45.1 Jackson Laboratories B6.SJL-Ptprca Pepcb/BoyJ
    Oligonucleotides
    RpL32 FW: TTCCTGGTCCACAATGTCAA Ordered from IDT mouseprimerdepot.nci.nih.gov
    RpL32 REV: GGCTTTTCGGTTCTTAGAGGA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1b FW: GGTCAAAGGTTTGGAAGCAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1b REV: TGTGAAATGCCACCTTTTGA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1a FW: CCAGAAGAAAATGAGGTCGG Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL1a REV: AGCGCTCAAGGAGAAGACC Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL17A FW: TGAGAGCTGCCCCTTCACTT Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL17A REV: ACGCAGGTGCAGCCCA Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL22 FW: CATGCAGGAGGTGGTACCTT Ordered from IDT mouseprimerdepot.nci.nih.gov
    IL22 REV: CAGACGCAAGCATTTCTCAG Ordered from IDT mouseprimerdepot.nci.nih.gov
    RORc FW: CCGCTGAGAGGGCTTCAC